Detail of EST/Unigene SRR027941.302135 |
Acc. | SRR027941.302135 |
Internal Acc. | E4GDP0P02JJSUF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-29; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=4e-29; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-29; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-29; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=6e-29; |
Length | 301 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGCGTTCTTAATTTCCTTAACCTTAAGCTCAGCAAAAGCCTCTGGGTCTTCAGCAAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |