| Detail of EST/Unigene SRR027941.306086 |
| Acc. | SRR027941.306086 |
| Internal Acc. | E4GDP0P02I11BY |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=7e-09; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=7e-08; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=1e-07; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Hordeum vulgare E-value=2e-07; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=3e-07; |
| Length | 279 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGAAATCTGTCATTTATAACCTTGGCCAAGGGTAGTCTTAAGGTCAATTTGTGGTACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |