| Detail of EST/Unigene SRR027941.320367 |
| Acc. | SRR027941.320367 |
| Internal Acc. | E4GDP0P02IBMLE |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=4e-18; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=2e-14; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=3e-14; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Homo sapiens E-value=3e-14; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=5e-14; |
| Length | 270 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGTGAGAAACATGGAAATAACTGACATTTTGTTAAGGAGTTGACTCAACTAATGCCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |