Detail of EST/Unigene SRR027941.65515 |
Acc. | SRR027941.65515 |
Internal Acc. | E4GDP0P01DRA0T |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-23; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=6e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=6e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=1e-07; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=4e-07; |
Length | 263 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGTCCTGAGCCTTCTTTGCATAAAATCTTCTGTACTTGGAATCAACTTCTGTTAGGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |