| Detail of EST/Unigene SRR027941.65515 |
| Acc. | SRR027941.65515 |
| Internal Acc. | E4GDP0P01DRA0T |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-23; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=6e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=6e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=1e-07; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=4e-07; |
| Length | 263 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGTCCTGAGCCTTCTTTGCATAAAATCTTCTGTACTTGGAATCAACTTCTGTTAGGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |