Detail of EST/Unigene SRR027941.67727 |
Acc. | SRR027941.67727 |
Internal Acc. | E4GDP0P01DKCEC |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=3e-08; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=3e-08; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=3e-08; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=3e-08; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=3e-08; |
Length | 247 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGCTCACCAAATTTTACACCGTTGCGGGCCAAGAGCTCAGGAAAGACACATCCAAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |