| Acc. |
SRR027941.88941 |
| Internal Acc. |
E4GDP0P01D3B92 |
| Type |
EST
|
| Annotation (Top 5 hits in Uniprot_trembl) |
Chalcone synthase 3 OS=Gerbera hybrida E-value=1e-18; Chalcone synthase 6 OS=Sorghum bicolor E-value=3e-18; Chalcone synthase 5 OS=Sorghum bicolor E-value=3e-18; Chalcone synthase 4 OS=Sorghum bicolor E-value=3e-18; Chalcone synthase 3 OS=Sorghum bicolor E-value=3e-18; |
| Length |
293 nt |
| Species |
Solanum habrochaites |
| Belonged EST Libraries |
SRR027941; |
| Sequence |
TCAGAGGCCANCCCTTTTTGGTGATGGGGCGGCCGCAATCATTATAGGTTCCGACCCAAT
TATAGGGTCGAAAGGCCTTTATTTGAACTCGTCTCAGCAGCCCAAACTCTGGTCCCCGAT
AGCGAAGACGCTATCGATGGACACCTCCGTGAGGTTGGGCTTACATTCCACTTACTCAAG
GATTGTTCCTGGGCTTATCTACGAAAAACNTACGAAAAGAGCCTTACTAAGGAAAGCCTA
ATTTTACCAAACCCTTCGTTAGGGTNTATCTGACTGGACTCTNTTATTTGATC
|
| EST members of Unigene |
N/A
|
| InterProScan Domain |
|
| Gene Ontology |
|
| KEGG Orthology |
|
| EC |
|
| Transcription Factor Family |
|
| Transporter Classification Family |
|
| Probeset |
|
| Corresponding NCBI Gene |
N/A
|
| Trichome-related Gene from Literature |
N/A
|