| Detail of EST/Unigene SRR027942.117273 |
| Acc. | SRR027942.117273 |
| Internal Acc. | E580B0E01B2Q0W |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=7e-15; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-13; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=5e-12; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=9e-12; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-11; |
| Length | 252 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGTGTATCAACGCAGAGTACGTGGGGATCTACAACTAACTTTTACATATCAAACTAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |