| Detail of EST/Unigene SRR027942.138177 |
| Acc. | SRR027942.138177 |
| Internal Acc. | E580B0E01D00ES |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Spinacia oleracea E-value=3e-22; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=1e-20; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=3e-20; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=9e-20; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=9e-20; |
| Length | 271 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGTCTGGATTCTTCTCCTTGAGGAACTTTTCCTAATTTCCTGATACCGTGCTCCAGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |