Detail of EST/Unigene SRR027942.140300 |
Acc. | SRR027942.140300 |
Internal Acc. | E580B0E01BM86K |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Spinacia oleracea E-value=4e-25; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=7e-22; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=9e-22; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-21; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=6e-20; |
Length | 283 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGTGTTGGGGTTCTGCTCTCTCAAATACTTGCCGTGAACCTGTTATTGTGCCTCCTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |