| Detail of EST/Unigene SRR027942.158920 |
| Acc. | SRR027942.158920 |
| Internal Acc. | E580B0E02F0PQV |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=6e-31; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=1e-25; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=3e-25; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=3e-25; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=7e-25; |
| Length | 250 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGAGACCGCGCTATCCGTGCATACTACAAGACCATAGCGTCATCCCATGAAGCACTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |