Detail of EST/Unigene SRR027942.179176 |
Acc. | SRR027942.179176 |
Internal Acc. | E580B0E02H0YUE |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=4e-10; Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; Levopimaradiene synthase, chloroplastic OS=Picea abies E-value=1e-08; Abietadiene synthase, chloroplastic OS=Abies grandis E-value=1e-08; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=2e-08; |
Length | 256 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGGATGTGCTACACAAGTTCAAAGATGGTGATGAATTCTTTTGCCTAAGAGGTGAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |