Detail of EST/Unigene SRR027942.219458 |
Acc. | SRR027942.219458 |
Internal Acc. | E580B0E02GT62Q |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=1e-32; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=3e-32; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=8e-32; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=2e-31; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=3e-31; |
Length | 250 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGGATAATCTACTGCTATTCGAATTCACCACTGCTTGATGATCAGCATTCTTGAACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |