Detail of EST/Unigene SRR027942.231531 |
Acc. | SRR027942.231531 |
Internal Acc. | E580B0E02FI3Q9 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=2e-13; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=6e-13; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=2e-12; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=4e-12; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=7e-12; |
Length | 281 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGCTGGATCGGTGTGCCGTTTGAGGCCAAGAGTAAGGTCAGGCTCTGGACACTTTGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |