| Detail of EST/Unigene SRR027942.231531 |
| Acc. | SRR027942.231531 |
| Internal Acc. | E580B0E02FI3Q9 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=2e-13; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=6e-13; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=2e-12; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=4e-12; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=7e-12; |
| Length | 281 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGCTGGATCGGTGTGCCGTTTGAGGCCAAGAGTAAGGTCAGGCTCTGGACACTTTGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |