| Acc. |
SRR027942.235380 |
| Internal Acc. |
E580B0E02G0D1K |
| Type |
EST
|
| Annotation (Top 5 hits in Uniprot_trembl) |
Chalcone synthase 2 OS=Solanum lycopersicum E-value=6e-36; Chalcone synthase 2 OS=Solanum tuberosum E-value=3e-35; Chalcone synthase OS=Antirrhinum majus E-value=7e-34; Chalcone synthase E OS=Ipomoea purpurea E-value=7e-34; Chalcone synthase E OS=Ipomoea nil E-value=7e-34; |
| Length |
284 nt |
| Species |
Solanum pimpinellifolium |
| Belonged EST Libraries |
SRR027942; |
| Sequence |
TCAGCCCAGGCCCAAATCCAAAAAGTACACCCCAATCAAGGCCTTCACCTGTGGTACTAA
GCCCTTCTTTGGATGAGGCCTTTCTCATTTCATCTAAAATAAATAGAACACAAGCACTAG
ACATATTTCCATAGTCACTTAAAACTTGCCTAGTAGCCCGAAGTTTTTCGGGCTTTAGGC
TCAGTTTTAGTTTCAACTTGATCTAGAATCGCCGGCCCACCAGGGTGCGCGATCCAAAAG
ATGGAATTCCAATCAGAAATGCCCGCGTACTCTGCGTTGATACC
|
| EST members of Unigene |
N/A
|
| InterProScan Domain |
|
| Gene Ontology |
|
| KEGG Orthology |
|
| EC |
|
| Transcription Factor Family |
|
| Transporter Classification Family |
|
| Probeset |
|
| Corresponding NCBI Gene |
N/A
|
| Trichome-related Gene from Literature |
N/A
|