Detail of EST/Unigene SRR027942.272687 |
Acc. | SRR027942.272687 |
Internal Acc. | E580B0E02HKA9F |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=7e-38; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=3e-37; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=7e-33; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=7e-33; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=1e-32; |
Length | 258 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGTTCAATGATATTTGCAATGCCTAAGTCAAGCCAGGAGAATTCAGCCGCTTTGATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |