| Detail of EST/Unigene SRR027942.279915 |
| Acc. | SRR027942.279915 |
| Internal Acc. | E580B0E02IHTY3 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-11; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=2e-08; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-08; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; |
| Length | 256 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGGTTACTTCCAGATAGATACATTGATCATGGTTCACCAGTTGATCAAATTGAAGCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |