Detail of EST/Unigene SRR027942.281962 |
Acc. | SRR027942.281962 |
Internal Acc. | E580B0E02HTVS2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=7e-33; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=2e-32; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=6e-32; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=2e-31; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=2e-20; |
Length | 263 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGTGTGACAGAGACTATGGTGTTCTAAACAAGGTCTTCCACAACATCACCGACACTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |