| Detail of EST/Unigene SRR027942.284688 |
| Acc. | SRR027942.284688 |
| Internal Acc. | E580B0E02INUPL |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=3e-21; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=5e-21; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-21; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=6e-21; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=8e-21; |
| Length | 277 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGCAAGGCCCAGTGGGTCAAAGCTACCACCAGGGTAGAGTGGGTCAACAACTCACCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |