| Detail of EST/Unigene SRR027942.286037 |
| Acc. | SRR027942.286037 |
| Internal Acc. | E580B0E02IXM2Z |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-39; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=1e-37; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; |
| Length | 274 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGACCAAACTAGGGTTTCCCAAGTAGTCAAGTCCGCCCTTCGTCTGAAAATTTGAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |