| Detail of EST/Unigene SRR027942.28671 |
| Acc. | SRR027942.28671 |
| Internal Acc. | E580B0E01EWQ8Y |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=1e-17; Naringenin,2-oxoglutarate 3-dioxygenase OS=Hordeum vulgare E-value=2e-17; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=3e-17; Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=6e-17; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=7e-17; |
| Length | 172 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGCCAAGGCATGTGTCGATATGGACCAAAAAGTTGTTGTGAATTTTTATCCAAAGTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |