| Detail of EST/Unigene SRR027942.290888 |
| Acc. | SRR027942.290888 |
| Internal Acc. | E580B0E02JR7DQ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=4e-26; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=3e-24; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=5e-23; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=2e-22; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=3e-22; |
| Length | 282 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGAAGAGTGGTATCAACGCAGAGTACGTCGGGGGTTTGCAGTGCAGTTTTCTCTGCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |