| Detail of EST/Unigene SRR027942.294418 |
| Acc. | SRR027942.294418 |
| Internal Acc. | E580B0E02G7VHJ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=4e-41; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=5e-40; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=4e-39; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=5e-37; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-27; |
| Length | 246 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGGTAGTCTCCGAGTAGTGGCTTGACTGCTTTGGTTGCCTCCATCGCGTTGTAGTGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |