| Detail of EST/Unigene SRR027942.30687 |
| Acc. | SRR027942.30687 |
| Internal Acc. | E580B0E01A4IT9 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=2e-36; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=9e-34; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=6e-32; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=8e-32; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=5e-31; |
| Length | 262 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGAGCTCATCCCAAGCTTCGATCCACGTGACCATAGCATCTCCTAGCTTGGTGAAATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |