| Detail of EST/Unigene SRR027942.35875 |
| Acc. | SRR027942.35875 |
| Internal Acc. | E580B0E01DGY34 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-22; Ent-copalyl diphosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-21; Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=6e-21; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=7e-20; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=9e-20; |
| Length | 269 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942; |
| Sequence | TCAGTTGTTGGATTCACCTCTTAGGCAAAAGAATTCATCACCATCTTTGAACTTGTGTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |