Detail of EST/Unigene SRR027942.43383 |
Acc. | SRR027942.43383 |
Internal Acc. | E580B0E01BEK9M |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=1e-17; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=1e-16; Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=1e-16; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=6e-16; |
Length | 253 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGTGATAAACATCACTCCTTTGTTTCTTTTATGAAGGCAAGTGTTCCATAAGGTTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |