Detail of EST/Unigene SRR027942.65210 |
Acc. | SRR027942.65210 |
Internal Acc. | E580B0E01DIYJQ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Abietadiene synthase, chloroplastic OS=Abies grandis E-value=1e-13; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=1e-13; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=3e-13; Levopimaradiene synthase, chloroplastic OS=Picea abies E-value=4e-13; Syn-copalyl diphosphate synthase OS=Oryza sativa subsp. japonica E-value=2e-12; |
Length | 265 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGAAGATCTCATCCATACCATTCCAACAATAGTATTGTTTTCATTAGAAGGATTAAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |