Detail of EST/Unigene SRR027942.79350 |
Acc. | SRR027942.79350 |
Internal Acc. | E580B0E01DMSD5 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-16; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-15; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-14; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=5e-14; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-14; |
Length | 260 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGTCTGCTGAGAGTCCAGCGGTTATTCCCTAGTCCGTTAGTTCTACCTAGGGTAATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |