Detail of EST/Unigene SRR027942.88842 |
Acc. | SRR027942.88842 |
Internal Acc. | E580B0E01B6JO1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=4e-08; Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=1e-07; Levopimaradiene synthase, chloroplastic OS=Picea abies E-value=3e-07; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=5e-07; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=9e-07; |
Length | 263 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942; |
Sequence | TCAGATGCGAGTTATTTTGGTAACGTTAGTGATTTAAAATCTGATCACTCAACAAGTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |