| Detail of EST/Unigene SRR546165.100229 |
| Acc. | SRR546165.100229 |
| Internal Acc. | G16PS2N02IJL8B |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=6e-31; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=6e-28; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=4e-22; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=1e-16; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=1e-16; |
| Length | 303 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | TTGTACCCAAAGGATGTCCAATGGCCATTGCACCTCCATTAACATTGATTTTTTCGGGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |