Detail of EST/Unigene SRR546165.102665 |
Acc. | SRR546165.102665 |
Internal Acc. | G16PS2N02FVNI7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=2e-58; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=2e-56; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-53; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-53; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=8e-53; |
Length | 370 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TCTCTCGTTCTCTGCTTCTTCAAGCAAGGCCTTGATCCAACCACCGCTTTGCTCGAACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |