Detail of EST/Unigene SRR546165.103112
Acc. SRR546165.103112
Internal Acc. G16PS2N02IWPII_1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 7 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=7e-07; Cellulose synthase A catalytic subunit 4 [UDP-forming] OS=Arabidopsis thaliana E-value=1e-06; Cellulose synthase A catalytic subunit 8 [UDP-forming] OS=Arabidopsis thaliana E-value=2e-06; Cellulose synthase A catalytic subunit 4 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=2e-06; Cellulose synthase A catalytic subunit 4 [UDP-forming] OS=Oryza sativa subsp. indica E-value=2e-06;
Length 75 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence ACAATTTCTCTTCCCCATTCTGTTTTCTCTTCGTAGCCACAACTAATGACATGAATTGCC
TCCTTGATTAATGCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A