Detail of EST/Unigene SRR546165.106991 |
Acc. | SRR546165.106991 |
Internal Acc. | G16PS2N02HTM63_2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 64 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | AGTACACAACTAAATTATTAGTTACTAAAACAAACAAACACACACACAATAATAATAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |