| Detail of EST/Unigene SRR546165.123696 |
| Acc. | SRR546165.123696 |
| Internal Acc. | G16PS2N02I86I4 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-32; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=2e-28; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-27; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=1e-15; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=2e-15; |
| Length | 383 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | TGTGTTAAAAGACATACATTTCCTCTTTATATGATAGGATTCTTAAAAAAGATACAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |