| Detail of EST/Unigene SRR546165.148005 |
| Acc. | SRR546165.148005 |
| Internal Acc. | G16PS2N02J277F |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=3e-37; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=3e-35; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=5e-35; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=1e-34; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=4e-33; |
| Length | 296 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | TCTTGAAGTAAGAGCTGGGGTTCCCATCCTAATTACCACCAGGAACCATGGCTGACACAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |