Detail of EST/Unigene SRR546165.149338 |
Acc. | SRR546165.149338 |
Internal Acc. | G16PS2N02IA92Z |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=8e-24; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-18; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-18; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-18; |
Length | 325 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | ACTTGACTACTTGGGAAACCCAAACTTGGTCCATGCTCAGAGCATTTTAGCGAATTTGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |