Detail of EST/Unigene SRR546165.15789 |
Acc. | SRR546165.15789 |
Internal Acc. | G16PS2N02HM9CQ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=3e-62; Glutathione reductase, chloroplastic OS=Glycine max E-value=4e-61; Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=2e-60; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=3e-57; Glutathione reductase, cytosolic OS=Pisum sativum E-value=2e-36; |
Length | 381 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | CGAAATCAGCTTTGGTCAAGCCAGCTTTGACAGCAATTGCGAATCCCTGCACAATTTCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |