Detail of EST/Unigene SRR546165.161890 |
Acc. | SRR546165.161890 |
Internal Acc. | G16PS2N02HKZO8 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-2,3-enoyl-CoA reductase OS=Bos taurus E-value=4e-09; Trans-2,3-enoyl-CoA reductase OS=Rattus norvegicus E-value=6e-09; Trans-2,3-enoyl-CoA reductase OS=Mus musculus E-value=6e-09; Trans-2,3-enoyl-CoA reductase OS=Homo sapiens E-value=6e-09; Trans-2,3-enoyl-CoA reductase OS=Dictyostelium discoideum E-value=2e-08; |
Length | 408 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | CGATACACCGGAAAGTAGTAAAATAGAGGATAAATGATCAGAGGACCCAAGTATTCGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |