| Detail of EST/Unigene SRR546165.168770 |
| Acc. | SRR546165.168770 |
| Internal Acc. | G16PS2N02JM5ST |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=5e-27; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-25; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-24; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=3e-23; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-23; |
| Length | 397 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | AGAGGCCAAACGGCCCAATTGTTAAAATAAGCCGCCACAGCCGCCAAACCAAAAACGACG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |