| Detail of EST/Unigene SRR546165.16901 |
| Acc. | SRR546165.16901 |
| Internal Acc. | G16PS2N02JAR3Y_2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-09; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=4e-09; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-08; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-08; |
| Length | 168 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | AAGGAGAACAAAGCTTGAAACTTCTCTTCTCTTTCATTGCTTGTAAATCATAATGGCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |