| Detail of EST/Unigene SRR546165.185183 |
| Acc. | SRR546165.185183 |
| Internal Acc. | G16PS2N02H6FZM_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-12; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Arabidopsis thaliana E-value=1e-11; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Pan troglodytes E-value=9e-07; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Pan paniscus E-value=9e-07; Succinate-semialdehyde dehydrogenase, mitochondrial OS=Homo sapiens E-value=9e-07; |
| Length | 133 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | GATGCCACAGGTCCAAATATTTCCTCTCTTGATATACGCATCTCATTATTGGTGTCACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |