Detail of EST/Unigene SRR546165.19831 |
Acc. | SRR546165.19831 |
Internal Acc. | G16PS2N02INO36_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=9e-36; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=4e-35; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-33; Alternative oxidase, mitochondrial OS=Typhonium venosum E-value=1e-32; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=8e-32; |
Length | 231 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | AAGCATTGAAGAAGACTCCCTGAACGGCTAGAACCAGTAGTCTCTCGTACCATTTGGGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |