| Detail of EST/Unigene SRR546165.19831 |
| Acc. | SRR546165.19831 |
| Internal Acc. | G16PS2N02INO36_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=9e-36; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=4e-35; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-33; Alternative oxidase, mitochondrial OS=Typhonium venosum E-value=1e-32; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=8e-32; |
| Length | 231 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | AAGCATTGAAGAAGACTCCCTGAACGGCTAGAACCAGTAGTCTCTCGTACCATTTGGGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |