Detail of EST/Unigene SRR546165.210469
Acc. SRR546165.210469
Internal Acc. G16PS2N02IPOTD
Type EST
Annotation (Top 5 hits in Uniprot_trembl) L-type lectin-domain containing receptor kinase IV.1 OS=Arabidopsis thaliana E-value=4e-07; L-type lectin-domain containing receptor kinase V.9 OS=Arabidopsis thaliana E-value=7e-07; Putative L-type lectin-domain containing receptor kinase V.2 OS=Arabidopsis thaliana E-value=2e-06; L-type lectin-domain containing receptor kinase S.4 OS=Arabidopsis thaliana E-value=2e-06; Putative L-type lectin-domain containing receptor kinase V.1 OS=Arabidopsis thaliana E-value=2e-06;
Length 100 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence CGGCCGGGGGCTGTCAAAAGAATCTCTCACGAATCAAGACAGGGTATGAGAGAATTCGTG
GCTGAAATTGTAACTCTCGGCCAGCTCCGACACCGGAATG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A