Detail of EST/Unigene SRR546165.221367 |
Acc. | SRR546165.221367 |
Internal Acc. | G16PS2N02J4URI |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=2e-20; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=6e-19; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=2e-18; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=5e-11; |
Length | 287 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TCATATTGCAGAGGTCTCTGTTCATCATGAAGACTTCCAAACACTGGAAGAATTCGTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |