Detail of EST/Unigene SRR546165.225280 |
Acc. | SRR546165.225280 |
Internal Acc. | G16PS2N02JX1WK_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic OS=Glycine max E-value=4e-56; Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=3e-55; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=4e-52; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=4e-46; Glutathione reductase, cytosolic OS=Pisum sativum E-value=5e-32; |
Length | 380 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | CGAAATCAGCTTTGGTCAAGCCAGCTTTGACAGCAATTGCGAATCCCTGCACAATTTCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |