| Detail of EST/Unigene SRR546165.235165 |
| Acc. | SRR546165.235165 |
| Internal Acc. | G16PS2N02IEKBU_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=3e-11; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=3e-11; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-08; Pyruvate carboxylase subunit A OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=4e-07; |
| Length | 93 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | TTTCCTCAACTCTGGGGTCAATGCAGGAGAGGGCGCTTCTTCCAGAAGCTTTTGATTCCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |