Detail of EST/Unigene SRR546165.235165
Acc. SRR546165.235165
Internal Acc. G16PS2N02IEKBU_1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=3e-11; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=3e-11; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-08; Pyruvate carboxylase subunit A OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=4e-07;
Length 93 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence TTTCCTCAACTCTGGGGTCAATGCAGGAGAGGGCGCTTCTTCCAGAAGCTTTTGATTCCG
CCTCTGGATACTGCAATCACGTTCTCCAAAGTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A