Detail of EST/Unigene SRR546165.25503 |
Acc. | SRR546165.25503 |
Internal Acc. | G16PS2N02J3FA2 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=3e-46; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=1e-45; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-45; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=3e-44; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=3e-43; |
Length | 372 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TTTCACTACAAAACATATTGGACATGGTAGCTGATTGGACCCCGGAAGAAAGGCAAATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |