Detail of EST/Unigene SRR546165.272522 |
Acc. | SRR546165.272522 |
Internal Acc. | G16PS2N02GKTIO |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | COP9 signalosome complex subunit 2 OS=Arabidopsis thaliana E-value=4e-18; COP9 signalosome complex subunit 2 OS=Dictyostelium discoideum E-value=1e-12; COP9 signalosome complex subunit 2 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=2e-11; COP9 signalosome complex subunit 2 (Fragment) OS=Xenopus laevis E-value=1e-10; COP9 signalosome complex subunit 2 OS=Rattus norvegicus E-value=1e-10; |
Length | 134 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | AAGAATGAGAGACTTTGGTTCAAGACAAATCTTAAGCTTTGCAAGATCTGGTTTGATATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |