Detail of EST/Unigene SRR546165.272680 |
Acc. | SRR546165.272680 |
Internal Acc. | G16PS2N02GBTPF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-54; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-54; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=7e-54; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=9e-54; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=9e-54; |
Length | 347 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | GGATCTGTCACCTCACCAAGTGGCCCACCTCCAATTCTGTACCCCTCTACAGCTCCCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |