| Detail of EST/Unigene SRR546165.284805 |
| Acc. | SRR546165.284805 |
| Internal Acc. | G16PS2N02IU2S6 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=2e-16; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=2e-15; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=2e-15; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-10; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-10; |
| Length | 148 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165; |
| Sequence | AAACCAAACATAGAGAACATAGCCAATCTCCCATTCTTGAGTTCCTTCACCTTCAGCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |