Detail of EST/Unigene SRR546165.286296 |
Acc. | SRR546165.286296 |
Internal Acc. | G16PS2N02JD3A3 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-64; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=4e-64; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=4e-64; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=5e-64; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=1e-63; |
Length | 406 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165; |
Sequence | TGGCCTGAACGAAGAAACCAAACATAGAGAACATAGCCAATCTCCCATTCTTGAGTTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |